Code & proteine genetiques

Aller en bas

Code & proteine genetiques

Message par Summer le Dim 1 Nov - 21:52

Bonjour , voila j'ai deux exercices en Svt sur lesquels je bloque :

1.
http://www.hiboox.fr/go/images-100/photo077,c3e56e10f2b89f3733fcba356d86aff4.jpg.html

J'ai fais la premiere partie de la question :
ocytocine : acgatgtaggtcttgacgggggacccg
ADH : acgatgaaggtcttgacgggttctcct

mais je comprend pas la 2e partie de la question quand ils demandent de representer les gènes codant pour ces deux hormones ..

2. http://www.hiboox.fr/go/images-100/photo078,e99141bfd7551319a11182a401323cf0.jpg.html

J'ai fais un tableau avec comme premiere colonne Acide aminées et la deuxieme colonne code possible
et donc 5 lignes en dessous de la premiere colonne avec : méthionine , phénylalanine, glycine, glycine, tyrosine. mais je n'arrive pas a etablir les possibilité de codage. Si vous pouviez m'aider s'il vous plait.

Voila donc en gros j'ai pas reussi a faire grand chose
Merci d'avance si vous pouvez m'eclairer..

Summer

Messages : 2
Date d'inscription : 01/11/2009

Revenir en haut Aller en bas

Re: Code & proteine genetiques

Message par Admin le Dim 1 Nov - 22:48

Exercice 1 : tu as répondu à la deuxième partie de la question, puisque tu as reconstitué le brin d'ADN codant. Il te suffit de représenter en face le brin non codant, et tu auras reconstitué le gène. Pour répondre à la première partie de la question, tu dois utiliser le code génétique. Par exemple, pour l'ocytocine et l'ADH, on voit que le codon UGC correspont à la cystéine.

Exercice 2 : on ne peut pas connaître précisément la séquence du gène de la met-enképhaline car il existe au moins deux possibilités pour la phénylalanine (AAA ou AAG), par exemple. Pour la question 2, il faut relever tous les codons possibles et faire un calcul de probabilités (avec X codons possibles, on a Y séquences possibles). study
avatar
Admin
Admin

Messages : 1114
Date d'inscription : 31/10/2007
Localisation : colomiers

http://forumsvt.forumpro.fr

Revenir en haut Aller en bas

Re: Code & proteine genetiques

Message par Summer le Lun 2 Nov - 13:56

D'accord , donc pour le 1 j'ai fait trouvé les acides aminées : cysteine : UGC , tyrosine : UAC, isoleucine : AUC, glutamine : CAG, asparagine : AAC , cysteine : UGC, proline : CCC, leucine : CUG, glucine : GGC .
et pour le 2e hormones : cysteine, tyrosine , phénylalanine, hlutamine, asparagine, cysteine, proline, arginine, glycine.

Question : Quand je trouve par exemple 2fois cysteine, je dois le marqué 2fois ?

ensuite j'ai donc ecrit les 2 brins transcrit que j'avais trouvé plus haut , mais dois je donner les 2brins non transcrit ?
Si oui , est ce ca : TGCTACATCCTGAACTGCCCCCTGGGC
et pour le 2e : TGCTACTTCCTGAACTGCCCTTGTGGT

par contre quand ils disent : legendez les brins de l'adn et expliquer votre reponse .. je sais pas trop quoi faire

Pour l'excerice 2 : j'ai donc fait en premier temps mon tableau avec une colone les acides aminées, et une autre où je met toute les possibilités de codes possibles que j'ai trouvé sur le code genetique. et j'ai donc repondu : Pour chaque code de trois bases (codons) il ne correspond qu'un seul acide aminé mais pour certains acides aminés, il peut correspondre plusieurs codes de trois bases donc on ne peut pas connaître précisément la séquence du gène de la met-enképhaline car il existe deux possibilités pour la phénylalanine (AAA ou AAG), 4 pour la glycine ( GGG ou GGA ou GGC ou GGU ) , et 2 pour la tyrosine ( UAC ou UAU ).

Par contre pour la question 2 je bloque , car par rapport a mon tableau j'ai trouvé 13 codons possible ( sachant qu'il y a 2 fois glycine ). et je l'ai multiplié par 5 car il y a 5 acides aminées donc 13 * 5 = 65. serait ce ca ?

Summer

Messages : 2
Date d'inscription : 01/11/2009

Revenir en haut Aller en bas

Re: Code & proteine genetiques

Message par Admin le Lun 2 Nov - 14:52

Exercice 1 :
-Si tu as trouvé deux codons poir la cystéine, alors c'est parce-que cet acide aminé est présent deux fois dans la protéine.
-Pour reconstituer les gènes, il faut les deux brins de l'ADN. Un est transcrit (c'est celui qui sert de base à l'ARN messager), tandis que l'autre n'est pas transcrit (on l'appelle le brin non transcrit).

Exercice 2 :
Je ne suis pas très doué pour les maths, mais je pense qu'il faut multiplier les nombres de cas possibles pour obtenir tous les cas. Cela devrait donner 2 x 4 x 2 = 16 possibiltés différentes (puisque 2 possibiltés pour la phénylalanine, 4 pour la glycine et 2 pour la tyrosine). study
avatar
Admin
Admin

Messages : 1114
Date d'inscription : 31/10/2007
Localisation : colomiers

http://forumsvt.forumpro.fr

Revenir en haut Aller en bas

Re: Code & proteine genetiques

Message par Contenu sponsorisé


Contenu sponsorisé


Revenir en haut Aller en bas

Revenir en haut

- Sujets similaires

 
Permission de ce forum:
Vous ne pouvez pas répondre aux sujets dans ce forum